circad | circRNAs associated with diseases

circ_004662
Gene		Organism	Human
Genome Locus		Build	hg19
Disease	Crohn Disease	ICD-10	Crohn disease [regional enteritis] (K50)
DBLink		PMID	31261517
Experimental Method
Sample Type	Tissue and cell lines	Comparison	5 patients of CD and 5 healthy controls
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TGTGGGAGCACGCTTACTAC Reverse GACCACCACCATTGAACTTCA	Statistics	Fold Change : Upregulated pvalue : <0.05
Citation
Yin, J, Hu, T, Xu, L, Li, P, Li, M, Ye, Y, Pang, Z (2019). Circular RNA expression profile in peripheral blood mononuclear cells from Crohn disease patients. Medicine (Baltimore), 98, 26:e16072.